Not seeing what you're looking for?
TATAA carries thousands of products from our huge list of distributors.
Continue Shopping
Vendor: TATAA Biocenter AB
TATAA two-tailed RT-qPCR microRNA assaysOur new TATAA miRNA two-Tailed RT-qPCR assays show exceeding performance compared to other techniques.
The challenge detecting small microRNAs is that two conventional PCR primers do not fit the target as their combined length is almost twice the length of the microRNA. Older techniques have solved this by extending the microRNA using eg., a hairpin primer, adding a poly A-tail, or adding a fragment by ligation. This, however, compromises the assay sensitivity and specificity, as only one of the PCR primers sense the actual microRNA sequence; the other senses the added extension. Further, these methods fail to detect microRNAs modified in the 3’-end as it interferes with the extension process.
TATAA miRNA two-Tailed RT-qPCR assays offers a superior solution. Instead of using a single binding probe, Two-tailed PCR uses two hemiprobes, which bind to different stretches of the microRNA, that are connected by a folded tether. While each hemiprobe is too short to bind the microRNA, when both hemiprobes are complementary they bind cooperatively.
Advantages
Contents
Assays currently available
miR-23a-3p (AUCACAUUGCCAGGGAUUUCC)miR-451a-5p (AAACCGUUACCAUUACUGAGUU)cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG)miR-1909-3p (CGCAGGGGCCGGGUGCUCACCG)miR-5739 (GCGGAGAGAGAAUGGGGAGC)miR-5001-5p (AGGGCUGGACUCAGCGGCGGAGCU)miR-3185 (AGAAGAAGGCGGUCGGUCUGCGG)miR-6795-5p (UGGGGGGACAGGAUGAGAGGCUGU)miR-122-5p (UGGAGUGUGACAAUGGUGUUUG)miR-16-5p (UAGCAGCACGUAAAUAUUGGCG)miR-199a-3p (ACAGUAGUCUGCACAUUGGUUA)miR-21-5p (UAGCUUAUCAGACUGAUGUUGA)
Customized AssaysTo place a customized assay order, Contact us
Two-tailed RT-qPCR assay is designed for microRNA. The assay is validated on RT and qPCR level on synthetic microRNA.