Welcome to shop.tataa!
Not seeing what you're looking for?
TATAA carries thousands of products from our huge list of distributors.
Continue Shopping
Vendor: TATAA Biocenter AB
You must Login to view pricing.
TATAA two-tailed RT-qPCR microRNA assays Our new TATAA miRNA two-Tailed RT-qPCR assays show exceeding performance compared to other techniques as recently published in NAR (see Product Documents).
The challenge detecting small microRNAs is that two conventional PCR primers do not fit the target as their combined length is almost twice the length of the microRNA. Older techniques have solved this by extending the microRNA using eg., a hairpin primer, adding a poly A-tail, or adding a fragment by ligation. This, however, compromises the assay sensitivity and specificity, as only one of the PCR primers sense the actual microRNA sequence; the other senses the added extension. Further, these methods fail to detect microRNAs modified in the 3’-end as it interferes with the extension process.
TATAA miRNA two-Tailed RT-qPCR assays offers a superior solution. Instead of using a single binding probe, Two-tailed PCR uses two hemiprobes, which bind to different stretches of the microRNA, that are connected by a folded tether. While each hemiprobe is too short to bind the microRNA, when both hemiprobes are complementary they bind cooperatively.
Advantages Binding is exceeding specific, as a mismatch is much more profound in a short hemiprobe The cDNA formed can then be PCR amplified using two sequence specific primers SYBR used for detection High degree two-tube multiplexing of the RT followed by singleplex qPCR
Contents 100 ul (2 uM) RT primer 100 ul (10 uM) qPCR primer
Assays currently available
miR-23a-3p (AUCACAUUGCCAGGGAUUUCC) miR-451a-5p (AAACCGUUACCAUUACUGAGUU) cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG) miR-1909-3p (CGCAGGGGCCGGGUGCUCACCG) miR-5739 (GCGGAGAGAGAAUGGGGAGC) miR-5001-5p (AGGGCUGGACUCAGCGGCGGAGCU) miR-3185 (AGAAGAAGGCGGUCGGUCUGCGG) miR-6795-5p (UGGGGGGACAGGAUGAGAGGCUGU) miR-122-5p (UGGAGUGUGACAAUGGUGUUUG) miR-16-5p (UAGCAGCACGUAAAUAUUGGCG) miR-199a-3p (ACAGUAGUCUGCACAUUGGUUA) miR-21-5p (UAGCUUAUCAGACUGAUGUUGA)
Customized Assays To place a customized assay order, Contact us.
Two-tailed RT-qPCR assay is designed for microRNA. The assay is validated on RT and qPCR level on synthetic microRNA.
Below, links to independent papers developing and using Two-Tailed PCR can be found
https://www.frontiersin.org/articles/10.3389/fpls.2019.01234/full https://www.mdpi.com/1422-0067/20/20/5131/htm#app1-ijms-20-05131
Click here for more papers citing Two-tailed PCR
Two-Tailed PCR presentations:
Dr Kubista presents Two-Tailed PCR at GQ2019: Click here>
Biovendor presentation on Two-Tailed PCR: Click Here>