All products in the webshop is for research use only. Not for use in diagnostic procedures.

TATAA two-tailed miRNA assays

qA-2T-1021

Vendor: TATAA Biocenter AB

TATAA two-tailed miRNA assays
€506.17
Maximum quantity available reached.

TATAA two-tailed RT-qPCR microRNA assays
Our new TATAA miRNA two-Tailed RT-qPCR assays show exceeding performance compared to other techniques.

The challenge detecting small microRNAs is that two conventional PCR primers do not fit the target as their combined length is almost twice the length of the microRNA. Older techniques have solved this by extending the microRNA using eg., a hairpin primer, adding a poly A-tail, or adding a fragment by ligation. This, however, compromises the assay sensitivity and specificity, as only one of the PCR primers sense the actual microRNA sequence; the other senses the added extension. Further, these methods fail to detect microRNAs modified in the 3’-end as it interferes with the extension process.

TATAA miRNA two-Tailed RT-qPCR assays offers a superior solution. Instead of using a single binding probe, Two-tailed PCR uses two hemiprobes, which bind to different stretches of the microRNA, that are connected by a folded tether. While each hemiprobe is too short to bind the microRNA, when both hemiprobes are complementary they bind cooperatively.

Advantages

  • Binding is exceeding specific, as a mismatch is much more profound in a short hemiprobe
  • The cDNA formed can then be PCR amplified using two sequence specific primers
  • SYBR used for detection
  • High degree two-tube multiplexing of the RT followed by singleplex qPCR


Contents

  • 100 ul (2 uM) RT primer
  • 100 ul (10 uM) qPCR primer

Assays currently available

miR-23a-3p (AUCACAUUGCCAGGGAUUUCC)
miR-451a-5p (AAACCGUUACCAUUACUGAGUU)
cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG)
miR-1909-3p (CGCAGGGGCCGGGUGCUCACCG)
miR-5739 (GCGGAGAGAGAAUGGGGAGC)
miR-5001-5p (AGGGCUGGACUCAGCGGCGGAGCU)
miR-3185 (AGAAGAAGGCGGUCGGUCUGCGG)
miR-6795-5p (UGGGGGGACAGGAUGAGAGGCUGU)
miR-122-5p (UGGAGUGUGACAAUGGUGUUUG)
miR-16-5p (UAGCAGCACGUAAAUAUUGGCG)
miR-199a-3p (ACAGUAGUCUGCACAUUGGUUA)
miR-21-5p (UAGCUUAUCAGACUGAUGUUGA) 

Customized Assays
To place a customized assay order, Contact us

Two-tailed RT-qPCR assay is designed for microRNA. The assay is validated on RT and qPCR level on synthetic microRNA.