HOME » Assays and Oligos » 2-tailed assays for microRNA » TATAA two-tailed miRNA assays

TATAA two-tailed miRNA assays

1 2 3 4 5
(4.7/5) Based on 26 rating.
miRNA Assay:
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR
195.00 EUR

Information

TATAA two-tailed RT-qPCR microRNA assays

Our new TATAA miRNA two-Tailed RT-qPCR assays show exceeding performance compared to other techniques as recently published in NAR (see Product Documents).

The challenge detecting small microRNAs is that two conventional PCR primers do not fit the target as their combined length is almost twice the length of the microRNA. Older techniques have solved this by extending the microRNA using eg., a hairpin primer, adding a poly A-tail, or adding a fragment by ligation. This, however, compromises the assay sensitivity and specificity, as only one of the PCR primers sense the actual microRNA sequence; the other senses the added extension. Further, these methods fail to detect microRNAs modified in the 3’-end as it interferes with the extension process.

TATAA miRNA two-Tailed RT-qPCR assays offers a superior solution. Instead of using a single binding probe, Two-tailed PCR uses two hemiprobes, which bind to different stretches of the microRNA, that are connected by a folded tether. While each hemiprobe is too short to bind the microRNA, when both hemiprobes are complementary they bind cooperatively.

Advantages

  • Binding is exceeding specific, as a mismatch is much more profound in a short hemiprobe
  • The cDNA formed can then be PCR amplified using two sequence specific primers
  • SYBR used for detection
  • High degree two-tube multiplexing of the RT followed by singleplex qPCR

 

Assays currently available

  • miR-23a-3p (AUCACAUUGCCAGGGAUUUCC)
  • miR-451a-5p (AAACCGUUACCAUUACUGAGUU)
  • cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG)
  • miR-1909-3p (CGCAGGGGCCGGGUGCUCACCG)
  • miR-5739 (GCGGAGAGAGAAUGGGGAGC)
  • miR-5001-5p (AGGGCUGGACUCAGCGGCGGAGCU)
  • miR-3185 (AGAAGAAGGCGGUCGGUCUGCGG)
  • miR-6795-5p (UGGGGGGACAGGAUGAGAGGCUGU)
  • miR-122-5p (UGGAGUGUGACAAUGGUGUUUG)
  • miR-16-5p (UAGCAGCACGUAAAUAUUGGCG)
  • miR-199a-3p (ACAGUAGUCUGCACAUUGGUUA)
  • miR-21-5p (UAGCUUAUCAGACUGAUGUUGA)

 

Customized Assays

To place a customized assay order, download the order form from Product Documents, fill it in and mail to: order@tataa.com

Two-tailed RT-qPCR assay is designed for microRNA. The assay is validated on RT and qPCR level on synthetic microRNA.

Below, links to independent papers developing and using Two-Tailed PCR can be found

https://www.frontiersin.org/articles/10.3389/fpls.2019.01234/full
https://www.mdpi.com/1422-0067/20/20/5131/htm#app1-ijms-20-05131

Click here for more papers citing Two-tailed PCR

 

 

Specifications

Partno: qA-2T-1021
Partno: qA-2T-1022
Partno: qA-2T-1024
Partno: qA-2T-1030
Partno: qA-2T-1032
Partno: qA-2T-1033
Partno: qA-2T-1034
Partno: qA-2T-1036
Partno: qA-2T-1038
Partno: qA-2T-1040
Partno: qA-2T-1044
Partno: qA-2T-1047

Opinions

Add review

Q4eBpR
Code from Captcha-image:

Rating (0)

You may also be interested in

  • TATAA Biocenter
    Robust and sensitive cDNA synthesis with user-defined RT priming
    from 126.65 EUR
    ( 149.00 EUR)
  • TATAA Biocenter
    The easy-to-use qPCR fastmix for all your gene expression experiments
    from 155.00 EUR
    ( 310.00 EUR)
  • TATAA Biocenter
    The TATAA SYBR® GrandMaster® Mix is a 2x concentrated ready to use fastmix wh...
    from 480.00 EUR
  • Other products of the same brand

  • TATAA Biocenter
    Background This kit is based on absolute quantification of your NGS librarie...
    Art. no. TA20-NGSQ
    359.20 EUR
    ( 449.00 EUR)
  • TATAA Biocenter
    Alu elements are short stretches of about 300 bp that are unique to the human...
    80.75 EUR
    ( 95.00 EUR)
  • TATAA Biocenter
    Robust and sensitive cDNA synthesis with user-defined RT priming
    from 126.65 EUR
    ( 149.00 EUR)
  • TATAA Biocenter
    Quantitative measurement of the biomining bacteria Acidithiobacillus caldus, ...
    Art. no. BQ-B01
    No price