HOME » Assays and Oligos » 2-tailed assays for microRNA » TATAA two-tailed miRNA assays

TATAA two-tailed miRNA assays

1 2 3 4 5
(4.6/5) Based on 30 rating.
miRNA Assay:
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00
€ 195.00

Information

TATAA two-tailed RT-qPCR microRNA assays

Our new TATAA miRNA two-Tailed RT-qPCR assays show exceeding performance compared to other techniques as recently published in NAR (see Product Documents).

The challenge detecting small microRNAs is that two conventional PCR primers do not fit the target as their combined length is almost twice the length of the microRNA. Older techniques have solved this by extending the microRNA using eg., a hairpin primer, adding a poly A-tail, or adding a fragment by ligation. This, however, compromises the assay sensitivity and specificity, as only one of the PCR primers sense the actual microRNA sequence; the other senses the added extension. Further, these methods fail to detect microRNAs modified in the 3’-end as it interferes with the extension process.

TATAA miRNA two-Tailed RT-qPCR assays offers a superior solution. Instead of using a single binding probe, Two-tailed PCR uses two hemiprobes, which bind to different stretches of the microRNA, that are connected by a folded tether. While each hemiprobe is too short to bind the microRNA, when both hemiprobes are complementary they bind cooperatively.

Advantages

  • Binding is exceeding specific, as a mismatch is much more profound in a short hemiprobe
  • The cDNA formed can then be PCR amplified using two sequence specific primers
  • SYBR used for detection
  • High degree two-tube multiplexing of the RT followed by singleplex qPCR

 

Contents

100 ul (2 uM) RT primer
100 ul (10 uM) qPCR primer

 Assays currently available

  • miR-23a-3p (AUCACAUUGCCAGGGAUUUCC)
  • miR-451a-5p (AAACCGUUACCAUUACUGAGUU)
  • cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG)
  • miR-1909-3p (CGCAGGGGCCGGGUGCUCACCG)
  • miR-5739 (GCGGAGAGAGAAUGGGGAGC)
  • miR-5001-5p (AGGGCUGGACUCAGCGGCGGAGCU)
  • miR-3185 (AGAAGAAGGCGGUCGGUCUGCGG)
  • miR-6795-5p (UGGGGGGACAGGAUGAGAGGCUGU)
  • miR-122-5p (UGGAGUGUGACAAUGGUGUUUG)
  • miR-16-5p (UAGCAGCACGUAAAUAUUGGCG)
  • miR-199a-3p (ACAGUAGUCUGCACAUUGGUUA)
  • miR-21-5p (UAGCUUAUCAGACUGAUGUUGA)

 

Customized Assays

To place a customized assay order, please contact order@tataa.com.

Two-tailed RT-qPCR assay is designed for microRNA. The assay is validated on RT and qPCR level on synthetic microRNA.

Below, links to independent papers developing and using Two-Tailed PCR can be found

https://www.frontiersin.org/articles/10.3389/fpls.2019.01234/full
https://www.mdpi.com/1422-0067/20/20/5131/htm#app1-ijms-20-05131

Click here for more papers citing Two-tailed PCR

Two-Tailed PCR presentations:

Dr Kubista presents Two-Tailed PCR at GQ2019: Click here>

Biovendor presentation on Two-Tailed PCR: Click Here>

 

 

Specifications

Partno: qA-2T-1021 100 ul (2 uM) RT primer 100 ul (10 uM) qPCR primer
Partno: qA-2T-1022
Partno: qA-2T-1024
Partno: qA-2T-1030
Partno: qA-2T-1032
Partno: qA-2T-1033
Partno: qA-2T-1034
Partno: qA-2T-1036
Partno: qA-2T-1038
Partno: qA-2T-1040
Partno: qA-2T-1044
Partno: qA-2T-1047

Opinions

Add review

hHPk
Code from Captcha-image:

Rating (0)

You may also be interested in

  • TATAA Biocenter
    Robust and sensitive cDNA synthesis with user-defined RT priming
    from € 149.00
  • TATAA Biocenter
    The easy-to-use qPCR fastmix for all your gene expression experiments
    from € 310.00
  • TATAA Biocenter
    The TATAA SYBR® GrandMaster® Mix is a 2x concentrated ready to use fastmix wh...
    from € 480.00
  • Other products of the same brand

  • TATAA Biocenter
    TATAA Facemask Nanofilter 5-pack Effective filter against bacteria and virus...
    No price
  • TATAA Biocenter
    TATAA Facemask Filters Efficient disposable filter to fit perfectly inside T...
    € 5.00
  • TATAA Biocenter
    TATAA Facemasks Our TATAA face masks are hand-sewn and made of 100% polyeste...
    € 12.00
  • TATAA Biocenter
    TATAA also has DBG assays for ApoE typing. Genotype ApoE4 has recently been i...
    No price